View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21016_high_9 (Length: 279)
Name: NF21016_high_9
Description: NF21016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21016_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 90 - 218
Target Start/End: Original strand, 28957854 - 28957983
Alignment:
| Q |
90 |
gatgggagaactgttaacacaaatcaaaaagcgcctctaatatgaaggtaaattctaaggtgccctcaagtttagaaggga-ttgatattctctcgacaa |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
28957854 |
gatgggagaactgttaacacaaatcaaaaagcgcttctaatatgaaggtaaattcaaaggtgccctcaagtttcgaagggatttgatattctctcgacaa |
28957953 |
T |
 |
| Q |
189 |
aattcatttagaatttgatttgatttttaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
28957954 |
aattcatttagaatttgatttgatttttaa |
28957983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University