View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21017_high_5 (Length: 252)
Name: NF21017_high_5
Description: NF21017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21017_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 188
Target Start/End: Complemental strand, 29549349 - 29549162
Alignment:
| Q |
1 |
gatggtgattttgcacatgacttcacaacattaagagttcccttcacagcagggtcgattaattgcgtctgaaacaagcaaaacacaacattcaaaaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29549349 |
gatggtgattttgcacatgacttcacaacattaagagttcccttcacagcagggtcgattaattgcgtctgaaacaagcaaaacacaacattcaaaaatt |
29549250 |
T |
 |
| Q |
101 |
aattaataatgtcatttttgctatttttactctaagaagctcatttgcatgttacaaaatacgacacggccaaaatacgttaacaaaa |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29549249 |
aattaataatgtcatttttgctatttttactctaagaagctcatttgcatgttacaaaatacgacacggccaaaatacgttaacaaaa |
29549162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 74
Target Start/End: Complemental strand, 29559279 - 29559206
Alignment:
| Q |
1 |
gatggtgattttgcacatgacttcacaacattaagagttcccttcacagcagggtcgattaattgcgtctgaaa |
74 |
Q |
| |
|
||||| ||||| ||||||||||| | ||||||||||||||||||||| |||||||||||||| || |||||||| |
|
|
| T |
29559279 |
gatggcgatttcgcacatgacttaagaacattaagagttcccttcactgcagggtcgattaactgtgtctgaaa |
29559206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 29555806 - 29555734
Alignment:
| Q |
1 |
gatggtgattttgcacatgacttcacaacattaagagttcccttcacagcagggtcgattaattgcgtctgaa |
73 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| |||||||||||||||| || |||||||| ||||||| |
|
|
| T |
29555806 |
gatggtgattttgcacatgatctcaaaacattaagacttcccttcacagcaggatcaattaattgtgtctgaa |
29555734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 25934308 - 25934263
Alignment:
| Q |
1 |
gatggtgattttgcacatgacttcacaacattaagagttcccttca |
46 |
Q |
| |
|
|||||||||||||||||||| | | |||||||||||||||||||| |
|
|
| T |
25934308 |
gatggtgattttgcacatgattgaagaacattaagagttcccttca |
25934263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University