View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21017_low_6 (Length: 209)
Name: NF21017_low_6
Description: NF21017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21017_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 1 - 191
Target Start/End: Original strand, 34688875 - 34689064
Alignment:
| Q |
1 |
ttcacacgaatatgagaaattagaagagaggattgcaacaaatattttggtagattaattaaagttttatatgtaaatttagaattaagatagtatttct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34688875 |
ttcacacgaatatgagaaattagaagagaggattgcaacaaatattttg-tagattaattaaagttttatatgtaaatttagaattaagatagtatttct |
34688973 |
T |
|
| Q |
101 |
tgagttattgcaaaaccctatgtataggaatacaatagtgtttttttaagctttgaggaccctggtccaagttaaagtttaaacatatttc |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34688974 |
tgagttattgcaaaaccctatgtataggaatacaatagtgtttttttaagctttgaggatcctggtccaagttaaagtttaaacatatttc |
34689064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University