View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21018_high_17 (Length: 251)
Name: NF21018_high_17
Description: NF21018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21018_high_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 67; Significance: 7e-30; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 18 - 92
Target Start/End: Complemental strand, 43663210 - 43663136
Alignment:
| Q |
18 |
tataggtaaaggtcatgctagaagagtgacacatatataactacgatttagttctttgttataataggtggtgtt |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
43663210 |
tataggtaaaggtcatgctagaagagtgacacatatataactacgatttagttgtttgttattataggtggtgtt |
43663136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 203 - 240
Target Start/End: Complemental strand, 43663025 - 43662988
Alignment:
| Q |
203 |
gataaataaaataaagaatataaagggtttgatttcat |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43663025 |
gataaataaaataaagaatataaagggtttgatttcat |
43662988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University