View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21018_high_17 (Length: 251)

Name: NF21018_high_17
Description: NF21018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21018_high_17
NF21018_high_17
[»] chr3 (2 HSPs)
chr3 (18-92)||(43663136-43663210)
chr3 (203-240)||(43662988-43663025)


Alignment Details
Target: chr3 (Bit Score: 67; Significance: 7e-30; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 18 - 92
Target Start/End: Complemental strand, 43663210 - 43663136
Alignment:
18 tataggtaaaggtcatgctagaagagtgacacatatataactacgatttagttctttgttataataggtggtgtt 92  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||    
43663210 tataggtaaaggtcatgctagaagagtgacacatatataactacgatttagttgtttgttattataggtggtgtt 43663136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 203 - 240
Target Start/End: Complemental strand, 43663025 - 43662988
Alignment:
203 gataaataaaataaagaatataaagggtttgatttcat 240  Q
    ||||||||||||||||||||||||||||||||||||||    
43663025 gataaataaaataaagaatataaagggtttgatttcat 43662988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University