View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21018_low_11 (Length: 296)
Name: NF21018_low_11
Description: NF21018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21018_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 17 - 279
Target Start/End: Complemental strand, 23654205 - 23653942
Alignment:
| Q |
17 |
tttgagaaggaggtccaaagttgaaactcatatactactactattaatattttccggtnnnnnnn-ttatgataatatttcatacaatgtacaagtacat |
115 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
23654205 |
tttgagaaggaggtccaaagatgaaactcatatactactactattaatattttccggtaaaaaaaattatgataatatttcatacaatgtacaagtacat |
23654106 |
T |
|
| Q |
116 |
gagatggtttatggtacaaaagttttgtttaannnnnnncctatttctttactattatagttgataaatagtatatattggtacttaccattttttatgt |
215 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23654105 |
gagatggtttatggtacaaaagttttttttaatttttttcctatttctttactattatagttgataaatagtatatattggtacttaccattttttatgt |
23654006 |
T |
|
| Q |
216 |
gtgtgaaggtggagttccatggggcagatggttgtggtggccctttgtacataggaactggatg |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23654005 |
gtgtgaaggtggagttccatggggcagatggttgtggtggccctttgtacataggaactggatg |
23653942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University