View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21018_low_22 (Length: 235)
Name: NF21018_low_22
Description: NF21018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21018_low_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 114; Significance: 6e-58; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 1 - 122
Target Start/End: Original strand, 33117235 - 33117356
Alignment:
| Q |
1 |
ctttgtcaatcacagtttcattgctcatcttgtcgaaaccacgtaaaatcctccctcctaaatcagtgagacccattctacagattatttagggtttcga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33117235 |
ctttgtcaatcacagtttcattgctcatcttgtcgaaaccacgtaaaatcctccctcctaaatcagcgagacccattctacagattatttagggtttcga |
33117334 |
T |
 |
| Q |
101 |
tatatgaagttttagtgtaaca |
122 |
Q |
| |
|
||||||||||||||| |||||| |
|
|
| T |
33117335 |
tatatgaagttttagggtaaca |
33117356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 137 - 220
Target Start/End: Original strand, 33117703 - 33117786
Alignment:
| Q |
137 |
tcaaaagttaaatttctagcatgcaatactcattatttgcattttcaagatagaaacaagaaataataaataaatagtttgata |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33117703 |
tcaaaagttaaatttctagcatgcaatacttattatttgcattttcaagatagaaacaagaaataataaataaatagtttgata |
33117786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University