View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21019_high_4 (Length: 291)
Name: NF21019_high_4
Description: NF21019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21019_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 4 - 276
Target Start/End: Complemental strand, 7666113 - 7665841
Alignment:
| Q |
4 |
atccatagtaacatcttcccatacctgagtgggtattggtagaggctgcaacaaccctgctggcagtgtagtcatatgtttagcctgctgacagatcaga |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7666113 |
atccatagtaacatcttcccatacctgagtgggtattggcagaggctgcaacaaccctgctggcagtgtagtcatatgtttagcctgctgacagatcaga |
7666014 |
T |
 |
| Q |
104 |
cattctgtgatgaacttgtgaaccgccgtcttcatatttggccaataaaattcagcacttattcgtgccatagtcctagtaatgcctgcatgccctccaa |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7666013 |
cattctgtgatgaacttgtgaaccgccgtcttcatatttggccaataaaattcagcacttattcgtgccatagtcctagtaatgcctgcatgccctccaa |
7665914 |
T |
 |
| Q |
204 |
tcggtgaagcatgaaactcttgcaacacttgttggattaatgaactatccaccggcaaaactagtttgttctt |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7665913 |
tcggtgaagcatgaaactcttgcaacacttgttggattaatgaactatccaccggcaaaactagtttgttctt |
7665841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University