View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21019_low_4 (Length: 291)

Name: NF21019_low_4
Description: NF21019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21019_low_4
NF21019_low_4
[»] chr1 (1 HSPs)
chr1 (4-276)||(7665841-7666113)


Alignment Details
Target: chr1 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 4 - 276
Target Start/End: Complemental strand, 7666113 - 7665841
Alignment:
4 atccatagtaacatcttcccatacctgagtgggtattggtagaggctgcaacaaccctgctggcagtgtagtcatatgtttagcctgctgacagatcaga 103  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7666113 atccatagtaacatcttcccatacctgagtgggtattggcagaggctgcaacaaccctgctggcagtgtagtcatatgtttagcctgctgacagatcaga 7666014  T
104 cattctgtgatgaacttgtgaaccgccgtcttcatatttggccaataaaattcagcacttattcgtgccatagtcctagtaatgcctgcatgccctccaa 203  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7666013 cattctgtgatgaacttgtgaaccgccgtcttcatatttggccaataaaattcagcacttattcgtgccatagtcctagtaatgcctgcatgccctccaa 7665914  T
204 tcggtgaagcatgaaactcttgcaacacttgttggattaatgaactatccaccggcaaaactagtttgttctt 276  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7665913 tcggtgaagcatgaaactcttgcaacacttgttggattaatgaactatccaccggcaaaactagtttgttctt 7665841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University