View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21021_low_7 (Length: 239)

Name: NF21021_low_7
Description: NF21021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21021_low_7
NF21021_low_7
[»] chr1 (1 HSPs)
chr1 (1-222)||(51577183-51577404)


Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 51577404 - 51577183
Alignment:
1 cggagctccggcccgaagccgttgacattcatatcgcagtcggagaggggaaataaggatccggctccggcggcttcgttgcaccggtcgcggacttcga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51577404 cggagctccggcccgaagccgttgacattcatatcgcagtcggagaggggaaataaggatccggctccggcggcttcgttgcaccggtcgcggacttcga 51577305  T
101 tggcggctagtaaggtgaagaaagctcttggactcaaaacgtcgtccttgaagaacaagcgtgcagtgacgactggggaattggtgagaacgcagatgag 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51577304 tggcggctagtaaggtgaagaaagctcttggactcaaaacgtcgtccttgaagaacaagcgtgcagtgacgactggggaattggtgagaacgcagatgag 51577205  T
201 aatctctgagcagagtgatact 222  Q
    ||||||||||||||||||||||    
51577204 aatctctgagcagagtgatact 51577183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University