View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21023_high_4 (Length: 264)
Name: NF21023_high_4
Description: NF21023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21023_high_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 94; Significance: 6e-46; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 134 - 259
Target Start/End: Original strand, 27438122 - 27438246
Alignment:
| Q |
134 |
ttgtgcaaccgaattcaagtccactatttaccaaaagtgagtaggacaaaagtatgcactgtcttgtgccctacaatcaaaatagaaaacacaacgtgta |
233 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||| ||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
27438122 |
ttgtgcaaccaaattcaagtccaa-atttaccaaaattgaataggacaaaagtatgcactgtcctgtgccctacaatcaaaatagaaaacacaacgtgta |
27438220 |
T |
 |
| Q |
234 |
gcatgaacgaggcttcctatgctact |
259 |
Q |
| |
|
||||||||||||||||||||| |||| |
|
|
| T |
27438221 |
gcatgaacgaggcttcctatgttact |
27438246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University