View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21023_low_9 (Length: 227)
Name: NF21023_low_9
Description: NF21023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21023_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 22 - 210
Target Start/End: Complemental strand, 43746339 - 43746155
Alignment:
| Q |
22 |
attgtaactataagtaataaccacatttcttttttaatctttattttatgtatgtattaggttttcatgtataaatctcatgattctgaattagacgatg |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43746339 |
attgtaactataagtaataaccacatttcttttttaatctttattttatgtat----taggttttcatgtataaatctcatgattctgaattagacgatg |
43746244 |
T |
 |
| Q |
122 |
gttaacaaggttgtaagtttttcccttcagtgtttcggtgctggcttgtgttgtctttgttttcgttttcgttttctccattgtacttc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43746243 |
gttaacaaggttgtaagtttttcccttcagtgtttcggtgctggcttgtgttgtctttgttttcgttttcgttttctccattgtacttc |
43746155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 35 - 68
Target Start/End: Original strand, 39118780 - 39118813
Alignment:
| Q |
35 |
gtaataaccacatttcttttttaatctttatttt |
68 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
39118780 |
gtaagaaccacatttcttttttaatctttatttt |
39118813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University