View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21025_high_3 (Length: 261)
Name: NF21025_high_3
Description: NF21025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21025_high_3 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 40 - 261
Target Start/End: Complemental strand, 37844114 - 37843893
Alignment:
| Q |
40 |
actagaaatacaataaaatnnnnnnnctaaccctggtggaacaaggaaggatccataaggaacaagcattccagcagtaggaagtgaaagagcaccaaga |
139 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37844114 |
actagaaatacaataaaataaaaaaactaaccctggtggaacaaggaaggatccataaggaacaagcattccagcagtaggaagtgaaagagcaccaaga |
37844015 |
T |
 |
| Q |
140 |
agaagaagattcaaggtctctctcttactcatgtcaggtacacgatcagcaggaatgcctgtagcctggcaagtgatgctcattcccttacctttaccaa |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37844014 |
agaagaagattcaaggtctctctcttactcatgtcaggtacacgatcagcaggaatgccagtagcctggcaagtgatgctcattcccttacctttaccaa |
37843915 |
T |
 |
| Q |
240 |
tcatctgagttcttgttggctt |
261 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
37843914 |
tcatctgagttcttgttggctt |
37843893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University