View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21026_low_12 (Length: 206)

Name: NF21026_low_12
Description: NF21026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21026_low_12
NF21026_low_12
[»] chr4 (2 HSPs)
chr4 (13-89)||(54257658-54257734)
chr4 (154-190)||(54257805-54257841)


Alignment Details
Target: chr4 (Bit Score: 65; Significance: 9e-29; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 13 - 89
Target Start/End: Original strand, 54257658 - 54257734
Alignment:
13 gaagaatatggaagttttattttattgtaaaacttaaaccaacaaaactcgagggactaatctatgtaaattggatc 89  Q
    |||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
54257658 gaagaaaatgaaagttttattttattgtaaaacttaaaccaacaaaactcgagggactaatctatctaaattggatc 54257734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 154 - 190
Target Start/End: Original strand, 54257805 - 54257841
Alignment:
154 aaaaacaacttgtagaaggagagagaaggaaatgatc 190  Q
    |||||||||||||||||||||||||||||||| ||||    
54257805 aaaaacaacttgtagaaggagagagaaggaaaggatc 54257841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University