View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21027_low_5 (Length: 269)
Name: NF21027_low_5
Description: NF21027
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21027_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 94; Significance: 6e-46; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 134 - 255
Target Start/End: Complemental strand, 33837125 - 33837005
Alignment:
| Q |
134 |
actcattcgataatcaaaatgattgttaaatggacattgttttcactcccaaaaagggaatatattaattgaggttatcaaactcatatatacacccaca |
233 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
33837125 |
actcattcgataatcaaaatgtttgttaaatggacattgttttcactcccaaaa-gggaatatataaattgaggttatcaaactcatatatacactcaca |
33837027 |
T |
|
| Q |
234 |
cttagcatcacccatggtcacc |
255 |
Q |
| |
|
||||||||||| ||| |||||| |
|
|
| T |
33837026 |
cttagcatcacacattgtcacc |
33837005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 38 - 112
Target Start/End: Complemental strand, 53879684 - 53879610
Alignment:
| Q |
38 |
gtaccgcatacggcgaggaagacgacgggggagttggattcacaacaatgataagtgtaaaaacaataaggaatt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53879684 |
gtaccgcatacggcgaggaagacgacgggggagttggattcacaacaatgataagtgtaaaaacaataaggaatt |
53879610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University