View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21028_high_26 (Length: 231)
Name: NF21028_high_26
Description: NF21028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21028_high_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 52030752 - 52030978
Alignment:
| Q |
1 |
aggtgcttcctacaaaaaagtttcggatcattggttttggagagagagagttttcgttaaatccgggtccttttaacgtgaaagaacacgtgcttatttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
52030752 |
aggtgcttcctacaaaaaagtttcggatcattggttttggagagagagagttttcgttaaatccgggtccttttaacgtgaaagagcacgtgcttatttc |
52030851 |
T |
|
| Q |
101 |
catgtttgcaaatgctggtgctgcgtttgggagtggcactgcttatgctctcagtattgttgatatcattcgtgtattttattacaggaagattaccttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52030852 |
catgtttgcaaatgctggtgctgcgtttgggagtggcactgcttatgctctcagtattgttgatatcattcgtgtattttattacaggaagattaccttt |
52030951 |
T |
|
| Q |
201 |
cttaccagttggattcttcttctcact |
227 |
Q |
| |
|
|||||||||||||||||| |||||||| |
|
|
| T |
52030952 |
cttaccagttggattcttgttctcact |
52030978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 50 - 131
Target Start/End: Original strand, 36900259 - 36900340
Alignment:
| Q |
50 |
gttttcgttaaatccgggtccttttaacgtgaaagaacacgtgcttatttccatgtttgcaaatgctggtgctgcgtttggg |
131 |
Q |
| |
|
||||||||| || || ||||| |||||| |||| ||||| || |||||| |||| |||||||||||||| |||||||||||| |
|
|
| T |
36900259 |
gttttcgtttaacccaggtccgtttaacatgaaggaacatgttcttattaccatatttgcaaatgctggggctgcgtttggg |
36900340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University