View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21028_high_31 (Length: 202)
Name: NF21028_high_31
Description: NF21028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21028_high_31 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 21 - 190
Target Start/End: Complemental strand, 34826780 - 34826611
Alignment:
| Q |
21 |
tggatggttcaatgaaccaaacaatatctcttttaactagggaggctagtgtagtaaaattgtgggtaatgaagattgttctaagatgatttgagttagc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34826780 |
tggatggttcaatgaaccaaacaatatctcttttaactagggaggctagtgtagtaaaattgtgggtaatgaagattgttctaagatgatttgagttagc |
34826681 |
T |
|
| Q |
121 |
ttctggtttgaaagtgagattctctaaaagtagactttctagtgtaaatgtcgattcttccttcatctca |
190 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
34826680 |
ttctggtttgaacgtgagattctctaaaagtagactttctagtgtaaatgtcgaatcttccttcatctca |
34826611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 131 - 188
Target Start/End: Original strand, 6843087 - 6843144
Alignment:
| Q |
131 |
aaagtgagattctctaaaagtagactttctagtgtaaatgtcgattcttccttcatct |
188 |
Q |
| |
|
||||||||||||||||| |||| ||||||| |||||| |||||||||||||| |||| |
|
|
| T |
6843087 |
aaagtgagattctctaagagtatactttctgatgtaaacgtcgattcttcctttatct |
6843144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 131 - 188
Target Start/End: Complemental strand, 9661908 - 9661851
Alignment:
| Q |
131 |
aaagtgagattctctaaaagtagactttctagtgtaaatgtcgattcttccttcatct |
188 |
Q |
| |
|
||||||||||||||||| |||| ||||||| || |||| |||||||||||||| |||| |
|
|
| T |
9661908 |
aaagtgagattctctaagagtatactttctggtataaacgtcgattcttcctttatct |
9661851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University