View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21028_low_20 (Length: 296)
Name: NF21028_low_20
Description: NF21028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21028_low_20 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 74; Significance: 6e-34; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 74 - 175
Target Start/End: Original strand, 33735638 - 33735739
Alignment:
| Q |
74 |
agtacttgtttaggtagtgtttggaaaagtttaaatagtacatgcccatgaattgatttcatccttaagatagtttataaaaacagtttaggtaaagctt |
173 |
Q |
| |
|
|||||||||||||||||||||| || |||||| || |||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33735638 |
agtacttgtttaggtagtgtttataagagtttacatggtacatacccatgaattgatttaatccttaagatagtttataaaaacagtttaggtaaagctt |
33735737 |
T |
 |
| Q |
174 |
at |
175 |
Q |
| |
|
|| |
|
|
| T |
33735738 |
at |
33735739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 16 - 114
Target Start/End: Original strand, 33735544 - 33735642
Alignment:
| Q |
16 |
tcatatggggcatttagaagagcttgatcagagttttttagatttataacatgacgtaagtacttgtttaggtagtgtttggaaaagtttaaatagtac |
114 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||||||||| |||||||||| | |||||||||||| |||| ||||||| |||||| ||||||| |
|
|
| T |
33735544 |
tcatatggggcatctagaagagcttgattagagttttttagatgcataacatgacatcagtacttgtttatatagtatttggaagagtttacatagtac |
33735642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 200 - 247
Target Start/End: Original strand, 33736594 - 33736641
Alignment:
| Q |
200 |
cttgaaactaaaccaattagagcttcttttttcacattcggcttgaac |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33736594 |
cttgaaactaaaccaattagagcttcttttttcacattcggcttgaac |
33736641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 112 - 175
Target Start/End: Complemental strand, 41711007 - 41710944
Alignment:
| Q |
112 |
tacatgcccatgaattgatttcatccttaagatagtttataaaaacagtttaggtaaagcttat |
175 |
Q |
| |
|
||||| ||||| |||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41711007 |
tacatacccataaattgattctgtccttaagatagtttataaaaacagtttagttaaagcttat |
41710944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University