View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21028_low_23 (Length: 266)
Name: NF21028_low_23
Description: NF21028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21028_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 22 - 248
Target Start/End: Original strand, 34465679 - 34465902
Alignment:
| Q |
22 |
ttaacgatgataatgcttcaagatcagatagtctccgtttgttcccaccaaacaccgctacttcagactccgtcgaccaaacaaccaacgacaagtcaag |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34465679 |
ttaacgatgataatgcttcaagatcagatagtctccgtttgttcccaccaaacaccgctacttcagactccgtcgaccaaacaaccaacgacaagtcaag |
34465778 |
T |
 |
| Q |
122 |
ttctatgtcggagttattcaaccttggaactataacaacaactttagatgacacaaaagcaacagcagagtcaagctgtaacggtaacagcaatgacggt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34465779 |
ttctatgtcggagttattcaaccttggaactat---aacaactttagatgacacaaaagcaacagcagagtcaagctgtaacggtaacagcaatgacggt |
34465875 |
T |
 |
| Q |
222 |
ttccctccgccgtaccggtatgttaca |
248 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
34465876 |
ttccctccgccgtaccggtatgttaca |
34465902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University