View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21028_low_28 (Length: 238)
Name: NF21028_low_28
Description: NF21028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21028_low_28 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 5e-86; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 62 - 238
Target Start/End: Complemental strand, 9335751 - 9335575
Alignment:
| Q |
62 |
ttgaggatttcattcatcatttatgtttccatatgactgaattgagttactggcccttgtggcaggtttttgcaaaaacccgtacattgtatttcatatt |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9335751 |
ttgaggatttcattcatcatttatgtttccatatgactgaattgagttactggcccttgtagcaggtttttgcaaaaacctgtacattgtatttcatatt |
9335652 |
T |
 |
| Q |
162 |
ggcctctagtgaccgctactgactggatcatttgcatatttaaatcatatggttcatttgatttattttctaatatt |
238 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9335651 |
ggcctctggtgaccgctactgaatggatcatttgcatatttaaatcatatggttcatttgatttattttctaatatt |
9335575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 35 - 65
Target Start/End: Complemental strand, 9336056 - 9336026
Alignment:
| Q |
35 |
tatttaacattttttatttgagtgaatttga |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
9336056 |
tatttaacattttttatttgagtgaatttga |
9336026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University