View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21028_low_35 (Length: 211)
Name: NF21028_low_35
Description: NF21028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21028_low_35 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 12 - 194
Target Start/End: Original strand, 42320182 - 42320365
Alignment:
| Q |
12 |
aagaatattgcagttaaaatcacaaatttcaccaatatacctgtggatgagaaccaaattgctgcatatttagttaatcacggtccacttgcaagtaagt |
111 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42320182 |
aagaaaattgcagttaaaatcacaaatttcaccaatatacctgtggatgagaaccaaattgctgcatatttagttaatcacggtccacttgcaagtaagt |
42320281 |
T |
|
| Q |
112 |
ccctttaattaatt-aattacaagttctaagatatatgcatgtgtgatgaattgtgaaacttagacggacactcacattgattg |
194 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42320282 |
ccctttaattaattaaattacaagttctaacatatatgcatgtgtgatgaattgtgaaacttagacggacactcacattgattg |
42320365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University