View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21028_low_9 (Length: 409)
Name: NF21028_low_9
Description: NF21028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21028_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 4e-94; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 4e-94
Query Start/End: Original strand, 112 - 294
Target Start/End: Complemental strand, 34465582 - 34465400
Alignment:
| Q |
112 |
tgacaatagcagcagcgtggcggtggttgtgtgtttgagtgtgatgttgtgggaggagtaaggaggagatgttggctgggaaagtggcgaggaaaggtgg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34465582 |
tgacaatagcagcagcgtggcggtggttgtgtgttcgagtgtggtgttgtgggaggagtaaggaggagatgttggctgggaaagtggcgaggaaaggtgg |
34465483 |
T |
|
| Q |
212 |
agaaggagggagtggtggtgaatagtaagatgggaagaatggtgtttgtggtggtgaagatgaagagatggaggaaaatggaa |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34465482 |
agaaggagggagtggtggtgaatagtaagatgggaagaatggtgtttgtggtggtgaagatgaagagatggaggaaaatggaa |
34465400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 34465693 - 34465618
Alignment:
| Q |
1 |
cattatcatcgttaatggtggtggaagaagttttgtggctgtgacggtggcggtggaaggcgaagacagtggaaat |
76 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34465693 |
cattatcatcgttaacggtggtggaagaagttttgtggctgtgacggtggcggtggaaggcgaagacagtggaaat |
34465618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University