View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21029_low_4 (Length: 215)
Name: NF21029_low_4
Description: NF21029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21029_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 30 - 198
Target Start/End: Complemental strand, 33695784 - 33695616
Alignment:
| Q |
30 |
gatactctaaagatatggggaatcaaaacatcgaaggagttttgcataatattgttattggctagccataaagacaatggataatcaagcaaacaataat |
129 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33695784 |
gatactctaaagatctgaggaatcaaaacatcgaaggagttttgcataatattgttattggctaaccataaagacaatggataatcaagcaaacaataat |
33695685 |
T |
|
| Q |
130 |
ttttcttagcctaattgacattttagattctatccatgaaaaaatagatagctaaaaatagccaatgtg |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33695684 |
ttttcttagcctaattgacattttagattctatccatgaaaaaatagatagctaaaaatagccaatgtg |
33695616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 124 - 161
Target Start/End: Complemental strand, 6334921 - 6334884
Alignment:
| Q |
124 |
aataatttttcttagcctaattgacattttagattcta |
161 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
6334921 |
aataatttttcttagcttaattgacattttagcttcta |
6334884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University