View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21030_high_6 (Length: 276)
Name: NF21030_high_6
Description: NF21030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21030_high_6 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 12 - 276
Target Start/End: Complemental strand, 609946 - 609682
Alignment:
| Q |
12 |
agagacaaaggatcaaaagaaaaaattttgtcaaaatttgggaggtgagaaaatgagaacaaagagttttccaccaccgttgaagagtatgagaggaaca |
111 |
Q |
| |
|
|||||||||||| ||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
609946 |
agagacaaaggaacaaaagaaaaattcttgtcaaaatttgggaggtgagaaaatgagaacaaagagttttccaccaccgttgaagagtatgagaggatca |
609847 |
T |
 |
| Q |
112 |
gaatctctaagagtgaaaccgcatagagaaaatggaaggttagtgattgagctaaccaaagttccatcaactgtttcttgcttccaagctgagagaagta |
211 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
609846 |
gaatctataagagtgaaaccacatagagaaaatggaaggttagtgattgagctaaccaaagttccatcaactgtttcttgcttccaagctgagagaagta |
609747 |
T |
 |
| Q |
212 |
atggaagacttcgtctttctttttggaatgatcccgaagaagatgaaaatcaagggtttgaggac |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
609746 |
atggaagacttcgtctttctttttggaatgatcccgaagaagatgaaaatcaagggtttgaggac |
609682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University