View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21030_high_8 (Length: 250)
Name: NF21030_high_8
Description: NF21030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21030_high_8 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-122; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 6 - 250
Target Start/End: Original strand, 2627860 - 2628104
Alignment:
| Q |
6 |
gtcgaagaatatgggagctacgatgaggttttctgtgtaacatcaaccccctatgattcacacatgtaattgaattttgtttttctttgattttctaccg |
105 |
Q |
| |
|
|||| |||| || |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2627860 |
gtcgtagaaaattggagctaccatgaggttttctgtgtaacatcaaccccctatgattcacacatgtaattgaattttgtttttctttgattttctacca |
2627959 |
T |
|
| Q |
106 |
ccttatcatatatcctttgtttgcaaagttgttctgtgtcaaggttgtaacaaggtgttgcatctcaccaaaactttcgaaatgaaatccgaagaggcag |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2627960 |
ccttatcatatatcctttgtttgcaaagttgttctgtgtcaaggttgtaacaaggtgttgcgtctcaccaaaactttcgaaatgaaatccgaagaggcag |
2628059 |
T |
|
| Q |
206 |
cagtagcactagtggagagagaaccatgtactggagagttagcca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2628060 |
cagtagcactagtggagagagaaccatgtactggagagttagcca |
2628104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 205 - 249
Target Start/End: Complemental strand, 2553220 - 2553176
Alignment:
| Q |
205 |
gcagtagcactagtggagagagaaccatgtactggagagttagcc |
249 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
2553220 |
gcagtagcactagtggagagaaaaccatggactggagagttagcc |
2553176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University