View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21030_low_18 (Length: 205)

Name: NF21030_low_18
Description: NF21030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21030_low_18
NF21030_low_18
[»] chr3 (2 HSPs)
chr3 (19-142)||(43118917-43119040)
chr3 (160-191)||(43119058-43119089)
[»] chr5 (3 HSPs)
chr5 (19-61)||(17484703-17484745)
chr5 (19-61)||(6782358-6782401)
chr5 (162-191)||(6784259-6784288)


Alignment Details
Target: chr3 (Bit Score: 120; Significance: 1e-61; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 19 - 142
Target Start/End: Original strand, 43118917 - 43119040
Alignment:
19 gagatttgggagtaattgtctcccaaactgagcaaacttgcaggttttgtgtgtgcaggtttcacatctctgaatggtagtcaaatgtccatgcatgttt 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43118917 gagatttgggagtaattgtctcccaaactgagcaaacttgcaggttttgtgtgtgcaggtttcacatctctgaatggtagtcaaatgtccatgcatgttt 43119016  T
119 gctattgtagcatgaaatatttgg 142  Q
    |||||||||||||||| |||||||    
43119017 gctattgtagcatgaagtatttgg 43119040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 160 - 191
Target Start/End: Original strand, 43119058 - 43119089
Alignment:
160 tctttgagattgcaaaactaaatcgattgatg 191  Q
    ||||||||||||||||||||||||||||||||    
43119058 tctttgagattgcaaaactaaatcgattgatg 43119089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 19 - 61
Target Start/End: Complemental strand, 17484745 - 17484703
Alignment:
19 gagatttgggagtaattgtctcccaaactgagcaaacttgcag 61  Q
    |||||||||||||||||||||||||||||||||||||||||||    
17484745 gagatttgggagtaattgtctcccaaactgagcaaacttgcag 17484703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 61
Target Start/End: Original strand, 6782358 - 6782401
Alignment:
19 gagatttgggag-taattgtctcccaaactgagcaaacttgcag 61  Q
    |||||||||||| |||||||||||||||||||||||||||||||    
6782358 gagatttgggaggtaattgtctcccaaactgagcaaacttgcag 6782401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 162 - 191
Target Start/End: Complemental strand, 6784288 - 6784259
Alignment:
162 tttgagattgcaaaactaaatcgattgatg 191  Q
    ||||||||||||||||||||||||||||||    
6784288 tttgagattgcaaaactaaatcgattgatg 6784259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University