View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21030_low_9 (Length: 320)
Name: NF21030_low_9
Description: NF21030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21030_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 45 - 298
Target Start/End: Original strand, 150961 - 151210
Alignment:
| Q |
45 |
tttgtttgtttgcataccgtaccatataatatatattggtgtgtgtgatcaatcgatcgatcgatcatccattattatacgttcatcgttcaaagaggga |
144 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
150961 |
tttgtttgtttgcataccgtactatataatatatattggtgtgtgtgatc----gatcgatcgatcatccattattatacgttcatcgttcaaagaggga |
151056 |
T |
|
| Q |
145 |
ttcattaatggagtcattaactgaggaaaggattgagataagagatgatcacaaacagccgttactcatcagaagcagaattaataactcttctcaactc |
244 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
151057 |
ttcattaatggagtcattaacagaggaaaggattgagataagagatgatcacaaacagccgttactcatcagaagcagaattaataactcttctcaactc |
151156 |
T |
|
| Q |
245 |
gccatcgttggagccaatatttgccctattcagagtcttgattacgagtcagta |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
151157 |
gccatcgttggagccaatatttgccctattcagagtcttgattacgagtcagta |
151210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University