View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21031_high_12 (Length: 305)
Name: NF21031_high_12
Description: NF21031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21031_high_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 1 - 291
Target Start/End: Complemental strand, 2113674 - 2113384
Alignment:
| Q |
1 |
tcaagaagtggacaaactgtatgagcctaacatcgagttgttttgtaacgtcgcggacgtggaaagacgaagaagattcggctgcgcttcttatgaggtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
2113674 |
tcaagaagtggacaaactgtatgagcctaacatcgagttgttttgtaacgtcgcggacgtggaaagacgaagaagattcggccgcgcttcttgtgaggtt |
2113575 |
T |
|
| Q |
101 |
tggactagcgaaaaggactaatctacatgatgatggatgttggcttcatttccattccattacacaaacatttgctaagagaacaggtggtttgaaattc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
2113574 |
tggactagcgaaaaggactaatctacatgatgatggatgttggcttcatttccattccattacacaaacattttctaagagaacaggtggtttgaaattc |
2113475 |
T |
|
| Q |
201 |
gcaaaggctgcaattcaaggagtaagaaaaatgaacaaacatgcaatctcggatcatttatgggaatcagcttttcttgtttttggattca |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2113474 |
gcaaaggctgcaattcaaggagtaagaaaaatgaacaaccatgcaatctcggatcatttatgggaatcagcttttcttgtttttggattca |
2113384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University