View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21032_high_2 (Length: 336)
Name: NF21032_high_2
Description: NF21032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21032_high_2 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 273
Target Start/End: Original strand, 34024994 - 34025266
Alignment:
| Q |
1 |
atatagaaaaaagggtgagggtagttttgtaatttgggatttgatgatttgatactgtgtgtgatttgagattggggaggtggaaatggataaggaggac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34024994 |
atatagaaaaaagggtgagggtagttttgtaatttgggatttgatgatttgatactgtgtgtgatttgagattggggaggtggaaatggataaggaggac |
34025093 |
T |
|
| Q |
101 |
ggtggggggagattgtatgcggtaaggtgcacgtaatgttatcgtgaaaactgaatgttaccacactgtaannnnnnnagaatcacggtggtggcccact |
200 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
34025094 |
ggtgggggaagattgtatgcggtaaggtgcacgtaatgttatcgtgaaaactgaatgttactacactgtaatttttttagaatcacggtggtggcccact |
34025193 |
T |
|
| Q |
201 |
agagctatatcttcagcaacaatgcttgcttcttcttactcgttcgacttcacaaccgtggaagttcaatttc |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
34025194 |
agagctatatcttcagcaacaatgcttgcttcttcttactcgttctacttcccaaccgtggaagttcaatttc |
34025266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University