View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21034_low_7 (Length: 318)
Name: NF21034_low_7
Description: NF21034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21034_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 1 - 307
Target Start/End: Complemental strand, 34921772 - 34921467
Alignment:
| Q |
1 |
ataaatagaggttcgttctctgctttttccatccacgaacttcacnnnnnnnaagttcgtttcaacggagttagcaaacgtgtgatataatatgtgttcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34921772 |
ataaatagaggttcgttctctgctttttc-atccacgaacttcactttttttaagttcgtttcaacggagttagcaaacgtgtgatataatatgtgttcc |
34921674 |
T |
 |
| Q |
101 |
ttccttaagcaacgtttatgggaatgcactgcagaggttagaaaaagattaccatttgaagaattctacccctttttacttcataaaattgttttataat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34921673 |
ttccttaagcaacgtttatgggaatgcactgcagaggttagaaaaagattaccatttgaagaattctacccctttttacttcataaaattgttttataat |
34921574 |
T |
 |
| Q |
201 |
ttgtaatcatttgaaaatatcacactcagttttcatccaacaatttcatcaatttgttcttaattttatattgaattggctctcatagtttttcttttag |
300 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| || |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34921573 |
ttgtaatcatttgaaaatatcacactcaattttcatctaagaatttcatcaatttgttcttaattttatattgaatttgctctcatagtttttcttttag |
34921474 |
T |
 |
| Q |
301 |
gtttcat |
307 |
Q |
| |
|
||||||| |
|
|
| T |
34921473 |
gtttcat |
34921467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University