View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21034_low_8 (Length: 260)
Name: NF21034_low_8
Description: NF21034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21034_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 18 - 252
Target Start/End: Complemental strand, 34921985 - 34921749
Alignment:
| Q |
18 |
gtatcttgctgtctgccatggcattgtactaattagtatatgttaagttctgtgtttttgtgttatgctttctatccgtgcattctagtttgaatgcact |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||| |
|
|
| T |
34921985 |
gtatcttgctgtctgccatggcattgtactaattagtgtatgttaagttctgtgtttttgtgttatgctttctattcgtgcattctagtttgaatggact |
34921886 |
T |
 |
| Q |
118 |
tcatttacaacttgannnnnnnn--gtagctgttaatttgttattattcctgataaaaataagttgagttcatgtatgacctctttatcatttcaatatt |
215 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34921885 |
tcatttacaacttgatttttttttagtagctgttaatttgttattattcctgataaaaataagttgagttcatgtatgacctctttatcatttcaatatt |
34921786 |
T |
 |
| Q |
216 |
catatgttcatccataaatagaggttcgttctctgct |
252 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34921785 |
catattttcatccataaatagaggttcgttctctgct |
34921749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University