View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21034_low_9 (Length: 239)
Name: NF21034_low_9
Description: NF21034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21034_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 18 - 233
Target Start/End: Original strand, 52998486 - 52998701
Alignment:
| Q |
18 |
atattcagatataaattttggtcgataaaatattaattggtagagaatcatattgatatggaggattggtatttctatctgcagaattaactactagcta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52998486 |
atattcagatataaattttggtcgataaaatattaattggtagagaatcatattgatatggaggattggtatttctatctgcagaattaactactagcta |
52998585 |
T |
|
| Q |
118 |
gttagacatttttgtttttcattcaattcccatgttctaaggtcaatattaatcccaaatatatacaatctcatcatgtagctaatgcaaccgcgtcttg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
52998586 |
gttagacatttttgtttttcattcaattcccatgttctaaggtcaatattaatcccaaatatatacaatctcatcatgtacctaatgcaaccgcgtcttg |
52998685 |
T |
|
| Q |
218 |
ttctttgttcttctct |
233 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
52998686 |
ttctttgttcttctct |
52998701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University