View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21035_high_2 (Length: 323)
Name: NF21035_high_2
Description: NF21035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21035_high_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 15 - 294
Target Start/End: Original strand, 28439902 - 28440181
Alignment:
| Q |
15 |
ggcggagggggcagatgggtggattgcctgtcaattatctgttgaaaagtaaaatttaaaaatattcaagcattatgaactggtccatacataaaatttt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28439902 |
ggcggagggggcagatgggtggattgcctgtcaattatctgttgaaaagtaaaatttaaaaatattcaagcattatgaactggtccatacataaaatttt |
28440001 |
T |
 |
| Q |
115 |
caactaatattataaattggattgggccatcgctaaaatgttaaatcaaccgacctgatacagatctaacatctgaagatttggacaatgcttcaggact |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28440002 |
caactaatattataaattggattgggccatcgctaaaatgttaaatcaaccgacctgatacagatctaacatctgaagatttggacaatgcttcaggact |
28440101 |
T |
 |
| Q |
215 |
tcaatagtcatctcatgccagtcgaaattaattaccaaatgtgtcaagtactgaaaaactgggaattcagaaggcagagg |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28440102 |
tcaatagtcatctcatgccagtcgaaattaattaccaaatgtgtcaagtactgaaaaactgggaattcagaaggcagagg |
28440181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University