View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21035_high_3 (Length: 312)
Name: NF21035_high_3
Description: NF21035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21035_high_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 29 - 298
Target Start/End: Complemental strand, 28812251 - 28811982
Alignment:
| Q |
29 |
acttgcaataaatcttgtgcatgaactctcactacattttgtgcctcttcaactgtttgatcagggacaacaagtccaaaatcaaatgcatttgcaccct |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28812251 |
acttgcaataaatcttgtgcatgaactctcactacattttgtgcctcttcaactgtttgatcagggacaacaagtccaaaatcaaatgcatttgcaccct |
28812152 |
T |
|
| Q |
129 |
ttgtcctaaatatgcactctccactaaaaatcaaccccaaatttcttctactgattttcagtgaaaaattcttctgatgtaaatgttggaaattataaga |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28812151 |
ttgtcctaaatatgcactctccactaaaaatcaaccccaaatttcttctactgattttcagtgaaaaattcttctgatgtaaatgttggaaattataagg |
28812052 |
T |
|
| Q |
229 |
tttgacacaacatgtgaattttggaaacaagtgtgtcatgttgggttgtaaggtaaatgttcttaactcc |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28812051 |
tttgacacaacatgtgaattttggaaacaagtgtgtcatgttgggttgtaaggtaaatgttcttaactcc |
28811982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University