View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21036_high_26 (Length: 303)
Name: NF21036_high_26
Description: NF21036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21036_high_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 96 - 290
Target Start/End: Original strand, 4357641 - 4357835
Alignment:
| Q |
96 |
tatgaatgtggtttgcattatatgatggtaaaagcccctcaaattgctcacattttcagaaaaataaccattcaaaggttacagtcgcgatcgagtttta |
195 |
Q |
| |
|
||||| ||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4357641 |
tatgagtgtggtttgcattatatgatggtaatagcccctcaaactgctcacattttcagaaaaataaccattcaaaggttacagccgcgatcgagtttta |
4357740 |
T |
 |
| Q |
196 |
ctcacgaaaaatattcatcgagcgtgggttatgacccgatcaattgagtaatttgagtgacttatattgaacaatcgtgttactagatggactct |
290 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4357741 |
ctcacaaaaaatattcatcgagggtgggttatgacccgatcaattgagtaatttgagtgacttatattgaacaatcgtgttactagatgggctct |
4357835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 26 - 77
Target Start/End: Original strand, 4357590 - 4357640
Alignment:
| Q |
26 |
attcaattttgttgttctccatacttaagtttttgttttgttgctgtgaaaa |
77 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||| ||| |||| |
|
|
| T |
4357590 |
attcaattttgttgttctcaatacttaag-ttttgttttgttgatgttaaaa |
4357640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 127 - 161
Target Start/End: Original strand, 9984675 - 9984709
Alignment:
| Q |
127 |
aagcccctcaaattgctcacattttcagaaaaata |
161 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9984675 |
aagcccctcaaattgctcacaatttcagaaaaata |
9984709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University