View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21036_high_40 (Length: 246)
Name: NF21036_high_40
Description: NF21036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21036_high_40 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 118; Significance: 3e-60; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 46 - 229
Target Start/End: Complemental strand, 26281885 - 26281702
Alignment:
| Q |
46 |
ggtcctaaattttttcctgtgcgttattttagttcagcttaattgcaatttcgatcctcgtannnnnnnatcgctcgcggaattaatctccccttttttg |
145 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||||||||||| ||| || |||||||||||||||||||| |||||||||| |
|
|
| T |
26281885 |
ggtcctaaattttttcctgtgaattattttagtttagcttaattgcaatttcgattctcatatttttttatcgctcgcggaattaatcttcccttttttg |
26281786 |
T |
 |
| Q |
146 |
aaatccannnnnnnggtcctctcacaattgaatttataattgacagtgtcactcacaattttgaatttaaaaacttgagtgaga |
229 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26281785 |
aaatccatttttttggtcctctcacaattgaatttataattgacagtgtcactcacaattttgaatttaaaaacttgagtgaga |
26281702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University