View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21036_high_44 (Length: 237)
Name: NF21036_high_44
Description: NF21036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21036_high_44 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 35455113 - 35454989
Alignment:
| Q |
1 |
acattcccatcattgtctttgacatagttttctcatccttgctaatttactctctgatttctatgtgcaattaacttttccatatctgtatatatatgta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35455113 |
acattcccatcattgtctttgacatagttttctcatccttgctaatttactctgtgatttctatgtgcaattaacttttccatatctgtatatatatgta |
35455014 |
T |
|
| Q |
101 |
aattcgtgtgattacttgttaagat |
125 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
35455013 |
aattcgtgtgattacttgttaagat |
35454989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 136 - 221
Target Start/End: Complemental strand, 35454930 - 35454844
Alignment:
| Q |
136 |
ttccaatttggttgcaataaaaacgacaatagatatattaa-tttcattatcttgatgctccatcaccaccaaattctaatggatca |
221 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35454930 |
ttccgatttggttgcaataaaaacgacaatagatatattaaatttcattatcttgatgctccatcaccaccaaattctaatagatca |
35454844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University