View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21036_high_46 (Length: 236)
Name: NF21036_high_46
Description: NF21036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21036_high_46 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 5 - 221
Target Start/End: Original strand, 39775654 - 39775871
Alignment:
| Q |
5 |
atccattgaacgtaactaatcacatacttgattggcgttaaccatctaaattgttgtcgatttttgttttagaatttgcatatcaaaatattatctccga |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39775654 |
atccattgaacgtaactaatcacatacttgattggcgttaaccatctaaattgttgtcgatttttgttttagaatttgcatatcaaaatattatctccga |
39775753 |
T |
|
| Q |
105 |
ttatgttttgaatatgttaagcacttggattaaaac-ttttaagaccaagtttatgtgttgttttagatgttgcagcacttcaaccatgaaatgcgtctt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39775754 |
ttatgttttgaatatgttaagcacttggattaaaactttttaagaccaagtttatgtgttgttttagatgttgcagcacttcaaccatgaaatgcgtctt |
39775853 |
T |
|
| Q |
204 |
gtaggagacactgcatct |
221 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
39775854 |
gtaggagacactgcatct |
39775871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University