View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21036_high_50 (Length: 203)
Name: NF21036_high_50
Description: NF21036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21036_high_50 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 15 - 187
Target Start/End: Complemental strand, 51807771 - 51807599
Alignment:
| Q |
15 |
agagaaattcaataggggtggtggagaatattatttcaaagggttggttgaggtatagtgcacttgtatctggagataaatattctattggaattcagga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51807771 |
agagaaattcaataggggtggtggagaatattatttcaaagggttggttgaggtatagtgcacttgtatctggagataaatattctattggaattcagga |
51807672 |
T |
|
| Q |
115 |
taatctggaatggggttggaagtgataataatttggaaaatcggttctcagattggttttgtggcagtgtaag |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
51807671 |
taatctggaatggggttggaagtgataataatttggaaaatcggttctcagattggttttgtggcagtataag |
51807599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University