View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21036_low_39 (Length: 278)
Name: NF21036_low_39
Description: NF21036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21036_low_39 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 8 - 260
Target Start/End: Complemental strand, 36128234 - 36127974
Alignment:
| Q |
8 |
tgagatgaatcgtgcaaatacataagaagtgagatgatacagatacgtgggattcctccgagagttatgg--------actccaaataatatgcagcaca |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36128234 |
tgagatgaatcgtgcaaatacataagaagtgagatgatatagatacgtgggattcctccgagagttatggtcttatggactccaaataatatgcagcaca |
36128135 |
T |
 |
| Q |
100 |
gcccattatgcagatgttaacatttagaatgagaaagatgtagaagggacaacaaaatattttcccctctttcatataatcgcctagattcccggagttt |
199 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||| | |||||||||| ||||||||| ||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
36128134 |
acccattatgcagaagttaatatttagaatgagaaggttgtagaaggggaaacaaaatagtttcccctctttcatataatcaccttgattcccggagttt |
36128035 |
T |
 |
| Q |
200 |
gttactcaagtcctctatataaagagttggtaatagtgaaatgaatcaagaagtaactaat |
260 |
Q |
| |
|
||||| || ||||||||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
36128034 |
gttacacatgtcctctatataaagagttggcaatagtgaaatgaatcaagaagtaattaat |
36127974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University