View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21036_low_40 (Length: 263)

Name: NF21036_low_40
Description: NF21036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21036_low_40
NF21036_low_40
[»] chr4 (1 HSPs)
chr4 (6-247)||(51848352-51848593)


Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 6 - 247
Target Start/End: Original strand, 51848352 - 51848593
Alignment:
6 agaagcaaaggcggcgacggaatgtaccgaacggcggcgaagcggttgctgtgcagcgcaaggcagttcaacggaaacgctgcactccggttccggcgtc 105  Q
    |||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51848352 agaaacaacggcggcgacggaatgtaccgaacggcggcgaagcggttgctgtgcagcgcaaggcagttcaacggaaacgctgcactccggttccggcgtc 51848451  T
106 ataatggattgataacttattctcgcttttccacaacagagattaatcaacctttttctaatccgcactctatccatgatgcaattcctatttcaaccac 205  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
51848452 ataatgcattgataacttattctcgcttttccacaacagagattaatcaacctttttctaatccacactctatccatgatgcaattcctatttcaaccac 51848551  T
206 cgaaatcgaaaaccctactctctatgattcaacttcttcttc 247  Q
    |||||||||||||||||||||||||||||| |||||||||||    
51848552 cgaaatcgaaaaccctactctctatgattccacttcttcttc 51848593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University