View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21036_low_40 (Length: 263)
Name: NF21036_low_40
Description: NF21036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21036_low_40 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 6 - 247
Target Start/End: Original strand, 51848352 - 51848593
Alignment:
| Q |
6 |
agaagcaaaggcggcgacggaatgtaccgaacggcggcgaagcggttgctgtgcagcgcaaggcagttcaacggaaacgctgcactccggttccggcgtc |
105 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51848352 |
agaaacaacggcggcgacggaatgtaccgaacggcggcgaagcggttgctgtgcagcgcaaggcagttcaacggaaacgctgcactccggttccggcgtc |
51848451 |
T |
 |
| Q |
106 |
ataatggattgataacttattctcgcttttccacaacagagattaatcaacctttttctaatccgcactctatccatgatgcaattcctatttcaaccac |
205 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
51848452 |
ataatgcattgataacttattctcgcttttccacaacagagattaatcaacctttttctaatccacactctatccatgatgcaattcctatttcaaccac |
51848551 |
T |
 |
| Q |
206 |
cgaaatcgaaaaccctactctctatgattcaacttcttcttc |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
51848552 |
cgaaatcgaaaaccctactctctatgattccacttcttcttc |
51848593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University