View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21036_low_45 (Length: 246)

Name: NF21036_low_45
Description: NF21036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21036_low_45
NF21036_low_45
[»] chr8 (1 HSPs)
chr8 (46-229)||(26281702-26281885)


Alignment Details
Target: chr8 (Bit Score: 118; Significance: 3e-60; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 46 - 229
Target Start/End: Complemental strand, 26281885 - 26281702
Alignment:
46 ggtcctaaattttttcctgtgcgttattttagttcagcttaattgcaatttcgatcctcgtannnnnnnatcgctcgcggaattaatctccccttttttg 145  Q
    |||||||||||||||||||||  ||||||||||| |||||||||||||||||||| ||| ||       |||||||||||||||||||| ||||||||||    
26281885 ggtcctaaattttttcctgtgaattattttagtttagcttaattgcaatttcgattctcatatttttttatcgctcgcggaattaatcttcccttttttg 26281786  T
146 aaatccannnnnnnggtcctctcacaattgaatttataattgacagtgtcactcacaattttgaatttaaaaacttgagtgaga 229  Q
    |||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26281785 aaatccatttttttggtcctctcacaattgaatttataattgacagtgtcactcacaattttgaatttaaaaacttgagtgaga 26281702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University