View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21036_low_46 (Length: 243)
Name: NF21036_low_46
Description: NF21036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21036_low_46 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 147 - 243
Target Start/End: Complemental strand, 26282158 - 26282062
Alignment:
| Q |
147 |
gtgacagtttcaaaagagttgaagcagttaattgttgttggccttccatgaaattgaataaattatttggtacttttaattaatatgaaaagttggt |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26282158 |
gtgacagtttcaaaagagttgaagcagttaattgttgttggccttccatgaaattgaataaattatttggtacttttaattaatatgaaaagttggt |
26282062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 2 - 102
Target Start/End: Complemental strand, 26282299 - 26282199
Alignment:
| Q |
2 |
gaaaagaatgatcatactattgaaagccatagaagaaatgaggaaaaatataatgttttatgnnnnnnngtgttcattgattgatttgatcataactgca |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
26282299 |
gaaaagaatgatcatactattgaaagccatagaagaaatgaggaaaaatataatgttttatgtttttttgtgttcattgattgatttgatcataactgca |
26282200 |
T |
 |
| Q |
102 |
a |
102 |
Q |
| |
|
| |
|
|
| T |
26282199 |
a |
26282199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University