View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21036_low_51 (Length: 236)

Name: NF21036_low_51
Description: NF21036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21036_low_51
NF21036_low_51
[»] chr8 (1 HSPs)
chr8 (5-221)||(39775654-39775871)


Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 5 - 221
Target Start/End: Original strand, 39775654 - 39775871
Alignment:
5 atccattgaacgtaactaatcacatacttgattggcgttaaccatctaaattgttgtcgatttttgttttagaatttgcatatcaaaatattatctccga 104  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39775654 atccattgaacgtaactaatcacatacttgattggcgttaaccatctaaattgttgtcgatttttgttttagaatttgcatatcaaaatattatctccga 39775753  T
105 ttatgttttgaatatgttaagcacttggattaaaac-ttttaagaccaagtttatgtgttgttttagatgttgcagcacttcaaccatgaaatgcgtctt 203  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39775754 ttatgttttgaatatgttaagcacttggattaaaactttttaagaccaagtttatgtgttgttttagatgttgcagcacttcaaccatgaaatgcgtctt 39775853  T
204 gtaggagacactgcatct 221  Q
    ||||||||||||||||||    
39775854 gtaggagacactgcatct 39775871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University