View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21038_low_12 (Length: 281)
Name: NF21038_low_12
Description: NF21038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21038_low_12 |
 |  |
|
| [»] scaffold0057 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 7e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 7e-89
Query Start/End: Original strand, 16 - 189
Target Start/End: Original strand, 23360893 - 23361066
Alignment:
| Q |
16 |
cagagaaactagcccagagagaaccaaagtttggactgaacccaaacccaaaacacccagaaaagtctctgtagtttactacctctcacgtaatggccac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23360893 |
cagagaaactagcccagagagaaccaaagtttggactgaacccaaacccaaaacacccagaaaagtctctgtagtttactacctctcacgtaatggccac |
23360992 |
T |
 |
| Q |
116 |
cttgagcacccccatttcatggaagtccctctctcttcaccccatggtctctacctcaaaggtatgtactctca |
189 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
23360993 |
cttgaacacccccatttcatggaagtccctctctcttcaccccatggtctctacctcaaaggtacgtactctca |
23361066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 192 - 232
Target Start/End: Complemental strand, 30162 - 30122
Alignment:
| Q |
192 |
tgtagcaccgacacttctgatcaaatgtgtgtctgatgtcc |
232 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
30162 |
tgtagtaccgacacttctgatcaaaggtgtgtctggtgtcc |
30122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University