View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21038_low_18 (Length: 250)
Name: NF21038_low_18
Description: NF21038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21038_low_18 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 11 - 250
Target Start/End: Original strand, 43531676 - 43531915
Alignment:
| Q |
11 |
cacagaccaaaactccaatatcagatccacacgtttcattcttgaatttgcctaatatatctgttcaactcaaaaaatgcactagtttgtcaatttttca |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43531676 |
cacaaaccaaaactccaatatcagatccacacgtttcattcttgaatttgcctaatatatctgttcaactcaaaaaatgcactagtttgtcaatttttca |
43531775 |
T |
 |
| Q |
111 |
gtcaatatatatttttagaaatgcaaggaaagagacaatggaattacctttaaagttaggcctgcctccaaaatgaacttcatgttcttcaagggtattc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43531776 |
gtcaatatatatttttagaaatgcaaggaaagagacaatggaattacctttaaagttaggcctgcctccaaaatgaacttcatgttcttcaagggcattc |
43531875 |
T |
 |
| Q |
211 |
ttagtttcagctgaacttggatcaaagggtttaatttcca |
250 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43531876 |
ttaggttcagctgaacttggatcaaagggtttaatttcca |
43531915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University