View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21038_low_22 (Length: 233)
Name: NF21038_low_22
Description: NF21038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21038_low_22 |
 | |
|
| [»] chr1 (4 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-122; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 45550901 - 45551133
Alignment:
| Q |
1 |
atattcctcagttctacttccttgttcttgagaatcttcctccaagactgttggcttctccaaattggccttgtattgctctggcttctcttccacagta |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45550901 |
atattcctcggttctacttccttgttcttgagaatcttcctccaagactgttggcgtctccaaattggccttgtattgctctggcttctcttccacagta |
45551000 |
T |
|
| Q |
101 |
aatgttttggcctggtcagtggacatgtttcgatcgatttcggtggttgatgaaacaccttcaacccgtggatcatgagaggattcttctcccgtacctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45551001 |
aatgttttggcctggtcagtggacatgtttcgatcgatttcggtggttgatgaaacaccttcaacccgtggatcatgagaggattcttctcccgtacctt |
45551100 |
T |
|
| Q |
201 |
caatatcaattcttgaatttcctaaattttcat |
233 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
45551101 |
caatatcaattcctgaatttcctaaattttcat |
45551133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 71
Target Start/End: Original strand, 45545674 - 45545744
Alignment:
| Q |
1 |
atattcctcagttctacttccttgttcttgagaatcttcctccaagactgttggcttctccaaattggcct |
71 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||||||| || || || ||||||||||||||| |
|
|
| T |
45545674 |
atatgcctcagctctacttccttgttcttgagaatcttcctccaagtctatttgcctctccaaattggcct |
45545744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 7 - 45
Target Start/End: Original strand, 45544882 - 45544920
Alignment:
| Q |
7 |
ctcagttctacttccttgttcttgagaatcttcctccaa |
45 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
45544882 |
ctcagttctacttccttgatcttgagaatcttcctccaa |
45544920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 45549670 - 45549714
Alignment:
| Q |
1 |
atattcctcagttctacttccttgttcttgagaatcttcctccaa |
45 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
45549670 |
atatgcctcagttctacttccttgatcttgagaatattcctccaa |
45549714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University