View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21038_low_24 (Length: 222)
Name: NF21038_low_24
Description: NF21038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21038_low_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 17 - 205
Target Start/End: Complemental strand, 49766229 - 49766041
Alignment:
| Q |
17 |
caaagggagtagttgctaattctaatggtattgcttctgtgaaccgtgctcaagaccaccaccaccatcaccatcattgcatgaaagagagagtacttag |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49766229 |
caaagggagtagttgctagttctaatggtattgcttctgtgaaccgtgctcaagaccaccaccaccatcaccatcattgcatgaaagagagagtacttag |
49766130 |
T |
|
| Q |
117 |
aaggtgtggaggaatattcagtggtttcatgatgacatcatcttcatcttcaaattcatctacttcatcttattgggtttcttctaatt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49766129 |
aaggtgtggaggaatattcagtggtttcatgatgacatcatcttcatcttcaaattcatctacttcatcttattgggtttcttctaatt |
49766041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University