View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2103_high_11 (Length: 252)
Name: NF2103_high_11
Description: NF2103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2103_high_11 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 252
Target Start/End: Original strand, 45496040 - 45496291
Alignment:
| Q |
1 |
tgaagtgggaatatgagggaagaataagaaatttttaggacatctcttcaaatttgtcaaaaccttatgtgtagccttgtaatgtgctaaggtaggacag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
45496040 |
tgaagtgggaatatgagggaagaataagcaatttttaggacatcccttcaaatttgtcaaaaccttatgtgtagccttgtaatgtgccaagataggacag |
45496139 |
T |
|
| Q |
101 |
tcttggaaaattgatttaattattgaaatagataagaaatgtttggccttgttgccaagtacaacaaattttcaaccaaggttctttactcagagacgca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
45496140 |
tcttggaaaattgatttaattattgaaatagataagaaatgtttggccttgttgccaagtacaacaaattttcaaccaaggttctttactcagagacaca |
45496239 |
T |
|
| Q |
201 |
tagagaaggggaattgttggatccattggtgtgctagatggtttgcatccca |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
45496240 |
tagagaaggggaattgttggatccattggtatactagatggtttgcatccca |
45496291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University