View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2103_high_14 (Length: 213)

Name: NF2103_high_14
Description: NF2103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2103_high_14
NF2103_high_14
[»] chr4 (1 HSPs)
chr4 (9-199)||(7311489-7311679)


Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 9 - 199
Target Start/End: Original strand, 7311489 - 7311679
Alignment:
9 acatcatcaaaaactagctagaggattcataaagtagtggtgttctcttggactttactactagactgatttccaattcgagtacatcttgcagcttgga 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7311489 acatcatcaaaaactagctagaggattcataaagtagtggtgttctcttggactttactactagactgatttccaattcgagtacatcttgcagcttgga 7311588  T
109 agatgttgaatccgaaagcttcaaaaaattgcgtgatgtatgataggcgagtagaatccggaattcacctatttttacattgtgaggaagt 199  Q
    | ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
7311589 atatgttgaatccgaaagcttcaaaaaattgcgtgatgtatgataggcgagtagattccggaattcacctatttttacattgtgaggaagt 7311679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University