View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2103_low_17 (Length: 213)
Name: NF2103_low_17
Description: NF2103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2103_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 9 - 199
Target Start/End: Original strand, 7311489 - 7311679
Alignment:
| Q |
9 |
acatcatcaaaaactagctagaggattcataaagtagtggtgttctcttggactttactactagactgatttccaattcgagtacatcttgcagcttgga |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7311489 |
acatcatcaaaaactagctagaggattcataaagtagtggtgttctcttggactttactactagactgatttccaattcgagtacatcttgcagcttgga |
7311588 |
T |
 |
| Q |
109 |
agatgttgaatccgaaagcttcaaaaaattgcgtgatgtatgataggcgagtagaatccggaattcacctatttttacattgtgaggaagt |
199 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7311589 |
atatgttgaatccgaaagcttcaaaaaattgcgtgatgtatgataggcgagtagattccggaattcacctatttttacattgtgaggaagt |
7311679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University